Regulog UxuR - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Glucuronate utilization; Galacturonate utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - GntR/Others
- By pathway - Glucuronate utilization
- By pathway - Galacturonate utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | ||
| Lactobacillus brevis ATCC 367 | 8 | 3 |
| Lactobacillus casei ATCC 334 | ||
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
| Lactobacillus fermentum IFO 3956 | ||
| Lactobacillus helveticus DPC 4571 | ||
| Lactobacillus johnsonii NCC 533 | ||
| Lactobacillus plantarum WCFS1 | ||
| Lactobacillus reuteri JCM 1112 | ||
| Lactobacillus rhamnosus GG | ||
| Lactobacillus sakei subsp. sakei 23K | ||
| Lactobacillus salivarius subsp. salivarius UCC118 | ||
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | ||
| Oenococcus oeni PSU-1 | ||
| Pediococcus pentosaceus ATCC 25745 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| aglX |
|
*
Lactobacillus brevis ATCC 367 Site: position = -259 score = 6.71987 sequence = AAAACTGATATATAAGCTAT Gene: LVIS_0137: Alpha-glucosidase, predicted |
|
|
|
|
|
|
|
|
|
|
|
|
|
Alpha-glucosidase, predicted |
| bglX |
|
Gene: LVIS_0138: Beta-galactosidase/glucuronidase |
|
|
|
|
|
|
|
|
|
|
|
|
|
Beta-galactosidase/glucuronidase |
| CRON 2. | ||||||||||||||||
| uxuB |
|
*
Lactobacillus brevis ATCC 367 Site: position = -86 score = 6.5775 sequence = AATACTGATATATAAGTTAT Gene: LVIS_0139: D-mannonate oxidoreductase (EC 1.1.1.57) |
|
|
|
|
|
|
|
Gene: LGG_00057: D-mannonate oxidoreductase (EC 1.1.1.57) |
|
|
|
|
|
D-mannonate oxidoreductase (EC 1.1.1.57) |
| yqhA |
|
Gene: LVIS_0140: Predicted aldose epimerase |
Gene: LSEI_2598: Predicted aldose epimerase |
|
|
|
Gene: LJ0171: Predicted aldose epimerase |
|
|
Gene: LGG_02577: Predicted aldose epimerase |
|
|
|
|
Gene: PEPE_1763: Predicted aldose epimerase |
Predicted aldose epimerase |
| pgmX |
Gene: LBA0339: Predicted phosphoglycerate mutase |
Gene: LVIS_0141: Predicted phosphoglycerate mutase |
|
Gene: LBUL_1611: Predicted phosphoglycerate mutase |
|
Gene: lhv_0352: Predicted phosphoglycerate mutase |
Gene: LJ0375: Predicted phosphoglycerate mutase |
|
Gene: LAR_0230: Predicted phosphoglycerate mutase |
|
|
|
|
|
|
Predicted phosphoglycerate mutase |
| pgdH |
|
Gene: LVIS_0142: Predicted 3-phosphoglycerate dehydrogenase |
|
|
|
|
|
|
|
|
|
|
|
|
|
Predicted 3-phosphoglycerate dehydrogenase |
| CRON 3. | ||||||||||||||||
| uidB |
|
*
Lactobacillus brevis ATCC 367 Site: position = -119 score = 6.71987 sequence = ATAGCTTATATATCAGTTTT Gene: LVIS_0136: Predicted oligogalacturonide transporter |
|
|
|
|
|
|
|
|
|
Gene: LSL_1933: Predicted oligogalacturonide transporter |
|
|
|
Predicted oligogalacturonide transporter |
| uxaC |
|
2
Lactobacillus brevis ATCC 367 Gene: LVIS_0135: Uronate isomerase (EC 5.3.1.12) Gene: LVIS_0150: Uronate isomerase (EC 5.3.1.12) |
|
|
|
|
|
|
|
|
Gene: LSA0129: Uronate isomerase (EC 5.3.1.12) |
|
|
|
|
Uronate isomerase (EC 5.3.1.12) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |