Regulon of BusR in Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Properties
Regulator type:	Transcription factor
TF locus tag:	LEUM_0356
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Betaine utilization
Effector:	Betaine
Regulog:	BusR - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By effector - Betaine
By pathway - Betaine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -103 Score: 7.7 Sequence: AGTGACAACCTATACTTTATAACAAGTTGTCTCT Locus tag: LEUM_0356 Name: busR Funciton: Betaine utilization transcriptional regulator BusR, GntR family
	LEUM_0356	busR	Betaine utilization transcriptional regulator BusR, GntR family
Position: -146 Score: 7.7 Sequence: AGAGACAACTTGTTATAAAGTATAGGTTGTCACT Locus tag: LEUM_0357 Name: busA Funciton: Glycine betaine ABC transporter, ATP-binding protein Locus tag: LEUM_0358 Name: busB Funciton: Glycine betaine ABC transporter, substrate binding and permease protein
	LEUM_0357	busA	Glycine betaine ABC transporter, ATP-binding protein
	LEUM_0358	busB	Glycine betaine ABC transporter, substrate binding and permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD