Regulog BusR - Lactobacillaceae

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Betaine utilization
Effector:	Betaine
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By effector - Betaine
By pathway - Betaine utilization

Statistics of regulated genes
Genome	Genes	Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367
Lactobacillus casei ATCC 334
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG
Lactobacillus sakei subsp. sakei 23K
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	3	2
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
busR	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	* Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Site: position = -103 score = 7.7416 sequence = AGTGACAACCTATACTTTATAACAAGTTGTCTCT Gene: LEUM_0356: Betaine utilization transcriptional regulator BusR, GntR family	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Betaine utilization transcriptional regulator BusR, GntR family

CRON 2.
busA	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334 Gene: LSEI_2145: Glycine betaine ABC transporter, ATP-binding protein	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG Gene: LGG_02148: Glycine betaine ABC transporter, ATP-binding protein	Lactobacillus sakei subsp. sakei 23K Gene: LSA1696: Glycine betaine ABC transporter, ATP-binding protein	Lactobacillus salivarius subsp. salivarius UCC118	* Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Site: position = -146 score = 7.7416 sequence = AGAGACAACTTGTTATAAAGTATAGGTTGTCACT Gene: LEUM_0357: Glycine betaine ABC transporter, ATP-binding protein	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Glycine betaine ABC transporter, ATP-binding protein
busB	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_0358: Glycine betaine ABC transporter, substrate binding and permease protein	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Glycine betaine ABC transporter, substrate binding and permease protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog BusR - Lactobacillaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --