Regulog BusR - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Betaine utilization |
| Effector: | Betaine |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - GntR/Others
- By effector - Betaine
- By pathway - Betaine utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | ||
| Lactobacillus brevis ATCC 367 | ||
| Lactobacillus casei ATCC 334 | ||
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
| Lactobacillus fermentum IFO 3956 | ||
| Lactobacillus helveticus DPC 4571 | ||
| Lactobacillus johnsonii NCC 533 | ||
| Lactobacillus plantarum WCFS1 | ||
| Lactobacillus reuteri JCM 1112 | ||
| Lactobacillus rhamnosus GG | ||
| Lactobacillus sakei subsp. sakei 23K | ||
| Lactobacillus salivarius subsp. salivarius UCC118 | ||
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | 3 | 2 |
| Oenococcus oeni PSU-1 | ||
| Pediococcus pentosaceus ATCC 25745 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| busR |
|
|
|
|
|
|
|
|
|
|
|
|
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Site: position = -103 score = 7.7416 sequence = AGTGACAACCTATACTTTATAACAAGTTGTCTCT Gene: LEUM_0356: Betaine utilization transcriptional regulator BusR, GntR family |
|
|
Betaine utilization transcriptional regulator BusR, GntR family |
| CRON 2. | ||||||||||||||||
| busA |
|
|
Gene: LSEI_2145: Glycine betaine ABC transporter, ATP-binding protein |
|
|
|
|
|
|
Gene: LGG_02148: Glycine betaine ABC transporter, ATP-binding protein |
Gene: LSA1696: Glycine betaine ABC transporter, ATP-binding protein |
|
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Site: position = -146 score = 7.7416 sequence = AGAGACAACTTGTTATAAAGTATAGGTTGTCACT Gene: LEUM_0357: Glycine betaine ABC transporter, ATP-binding protein |
|
|
Glycine betaine ABC transporter, ATP-binding protein |
| busB |
|
|
|
|
|
|
|
|
|
|
|
|
Gene: LEUM_0358: Glycine betaine ABC transporter, substrate binding and permease protein |
|
|
Glycine betaine ABC transporter, substrate binding and permease protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |