Regulon of CtsR in Streptococcus uberis 0140J

Properties
Regulator type:	Transcription factor
TF locus tag:	SUB1744
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Streptococcaceae
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 68 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 6.7 Sequence: TAAAGTTTGACCATTTTTGACTAA Locus tag: SUB1281 Name: clpE Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
	SUB1281	clpE	ATP-dependent Clp protease, ATP-binding subunit ClpE
Position: -108 Score: 6.6 Sequence: TTTTTCTTGACTAATTTTGACCAA Locus tag: SUB1742 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: SUB1741 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	SUB1742	groS	Heat shock protein 60 family co-chaperone GroES
	SUB1741	groL	Heat shock protein 60 family chaperone GroEL
Position: -152 Score: 6.9 Sequence: TTTTTCTTGACCTTTTTTGACCAA Locus tag: SUB0776 Name: clpL Funciton: ATP-dependent Clp protease, ATP-binding subunit
	SUB0776	clpL	ATP-dependent Clp protease, ATP-binding subunit
Position: -98 Score: 6.7 Sequence: TATTATTTGACCTTATTTGACCAA Locus tag: SUB0429 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	SUB0429	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD