Regulon of CtsR in Streptococcus thermophilus CNRZ1066

Properties
Regulator type:	Transcription factor
TF locus tag:	str0076
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Streptococcaceae
Statistics of regulated genes:
- Genes	7
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 68 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -84 Score: -0.1 Sequence: TTGGTCAGTAAAAGTCAATTTTTA Locus tag: str1614 Name: clpL Funciton: ATP-dependent Clp protease, ATP-binding subunit
	str1614	clpL	ATP-dependent Clp protease, ATP-binding subunit
Position: -75 Score: 6.5 Sequence: ATAGATTTGACCTTTTTTGACCAA Locus tag: str0602 Name: clpE Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
	str0602	clpE	ATP-dependent Clp protease, ATP-binding subunit ClpE
Position: -67 Score: 6.2 Sequence: TTTTATTTGACCTAATTTGACTAA Locus tag: str0356 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	str0356	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Position: -124 Score: 6.7 Sequence: TTTTTCTTGACTATTTTTGACTAA Locus tag: str0203 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: str0204 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	str0203	groS	Heat shock protein 60 family co-chaperone GroES
	str0204	groL	Heat shock protein 60 family chaperone GroEL
Position: -38 Score: -0.7 Sequence: ATAGTCAGTTATAGTCAAATTAGA Locus tag: str0076 Name: ctsR Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family Locus tag: str0077 Name: clpC Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
	str0076	ctsR	Stress and heat shock response transcriptional regulator CtsR, CtsR family
	str0077	clpC	ATP-dependent Clp protease ATP-binding subunit ClpC

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD