Regulon of CtsR in Streptococcus suis 05ZYH33

Properties
Regulator type:	Transcription factor
TF locus tag:	SSU05_1976
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Streptococcaceae
Statistics of regulated genes:
- Genes	10
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 68 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 6.1 Sequence: TTTTTATTGACCAATTTTGACTAT Locus tag: SSU05_1551 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92) Locus tag: SSU05_1550 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	SSU05_1551	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	SSU05_1550	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Position: -34 Score: -0.9 Sequence: ATGGTCAAAGATAGTCAAAGAAAG Locus tag: SSU05_1976 Name: ctsR Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family Locus tag: SSU05_1975 Name: clpC Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
	SSU05_1976	ctsR	Stress and heat shock response transcriptional regulator CtsR, CtsR family
	SSU05_1975	clpC	ATP-dependent Clp protease ATP-binding subunit ClpC
Position: -66 Score: 6.5 Sequence: ATGTTCTTGACTATTTTTGACCAA Locus tag: SSU05_0147 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: SSU05_0148 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL Locus tag: SSU05_0149 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	SSU05_0147	groS	Heat shock protein 60 family co-chaperone GroES
	SSU05_0148	groL	Heat shock protein 60 family chaperone GroEL
	SSU05_0149	groL	Heat shock protein 60 family chaperone GroEL
Position: -254 Score: 6.1 Sequence: AAACTATTGACTTTTACTGACCAA Locus tag: SSU05_0389 Name: clpL Funciton: ATP-dependent Clp protease, ATP-binding subunit Locus tag: SSU05_0390 Name: clpL Funciton: ATP-dependent Clp protease, ATP-binding subunit Locus tag: SSU05_0391 Name: clpL Funciton: ATP-dependent Clp protease, ATP-binding subunit
	SSU05_0389	clpL	ATP-dependent Clp protease, ATP-binding subunit
	SSU05_0390	clpL	ATP-dependent Clp protease, ATP-binding subunit
	SSU05_0391	clpL	ATP-dependent Clp protease, ATP-binding subunit

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD