Regulon of CtsR in Streptococcus sanguinis SK36

Properties
Regulator type:	Transcription factor
TF locus tag:	SSA_2200
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Streptococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 68 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -77 Score: -0.2 Sequence: TTAGTCAAAGATAGTCAATGTTAG Locus tag: SSA_2200 Name: ctsR Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family Locus tag: SSA_2199 Name: clpC Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
	SSA_2200	ctsR	Stress and heat shock response transcriptional regulator CtsR, CtsR family
	SSA_2199	clpC	ATP-dependent Clp protease ATP-binding subunit ClpC
Position: -103 Score: 6.6 Sequence: TTCTATTTGACCTTTTTTGACCAA Locus tag: SSA_1731 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	SSA_1731	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Position: -73 Score: 6.2 Sequence: AAAACTTTGACTATTTTTGACCTT Locus tag: SSA_0669 Name: clpE Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
	SSA_0669	clpE	ATP-dependent Clp protease, ATP-binding subunit ClpE
Position: -97 Score: 6.8 Sequence: TTTTTCTTGACTATTTCTGACCAA Locus tag: SSA_0225 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: SSA_0226 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	SSA_0225	groS	Heat shock protein 60 family co-chaperone GroES
	SSA_0226	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD