Regulon of CtsR in Streptococcus pyogenes M1 GAS

Properties
Regulator type:	Transcription factor
TF locus tag:	SPy2074
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Streptococcaceae
Statistics of regulated genes:
- Genes	7
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 68 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -125 Score: 6.6 Sequence: TATGATTTGACCTTTATTGACCAA Locus tag: SPy0395 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	SPy0395	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Position: -62 Score: 6.7 Sequence: TAAAGTTTGACCATTTTTGACTAA Locus tag: SPy1509 Name: clpE Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
	SPy1509	clpE	ATP-dependent Clp protease, ATP-binding subunit ClpE
Position: -78 Score: 0.1 Sequence: ATAGTCAGTTTTAGTCAAAATGTA Locus tag: SPy2074 Name: ctsR Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family Locus tag: SPy2073 Name: clpC Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
	SPy2074	ctsR	Stress and heat shock response transcriptional regulator CtsR, CtsR family
	SPy2073	clpC	ATP-dependent Clp protease ATP-binding subunit ClpC
Position: -107 Score: 6.9 Sequence: TTTTTCTTGACTATTTTTGACCAA Locus tag: SPy2072 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: SPy2070 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	SPy2072	groS	Heat shock protein 60 family co-chaperone GroES
	SPy2070	groL	Heat shock protein 60 family chaperone GroEL
Position: -172 Score: 6.3 Sequence: TTTTGTTTGACCTTTACTGACCTT Locus tag: SPy0888 Name: clpL Funciton: ATP-dependent Clp protease, ATP-binding subunit
	SPy0888	clpL	ATP-dependent Clp protease, ATP-binding subunit

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD