Regulon of CtsR in Streptococcus pneumoniae TIGR4

Properties
Regulator type:	Transcription factor
TF locus tag:	SP_2195
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Streptococcaceae
Statistics of regulated genes:
- Genes	7
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 68 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: -0.4 Sequence: ATAGTCAAACAAGGTCAAGGTTTA Locus tag: SP_2195 Name: ctsR Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family Locus tag: SP_2194 Name: clpC Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
	SP_2195	ctsR	Stress and heat shock response transcriptional regulator CtsR, CtsR family
	SP_2194	clpC	ATP-dependent Clp protease ATP-binding subunit ClpC
Position: -62 Score: 6.3 Sequence: TAGAATTTGACTATTTTTGACCTT Locus tag: SP_0820 Name: clpE Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
	SP_0820	clpE	ATP-dependent Clp protease, ATP-binding subunit ClpE
Position: -275 Score: 6.5 Sequence: AAACTCTTGACCTTTTCTGACCAA Locus tag: SP_0338 Name: clpL Funciton: ATP-dependent Clp protease, ATP-binding subunit
	SP_0338	clpL	ATP-dependent Clp protease, ATP-binding subunit
Position: -102 Score: 6.2 Sequence: TTTTTCTTGATTATTTCTGACCAA Locus tag: SP_1907 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: SP_1906 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	SP_1907	groS	Heat shock protein 60 family co-chaperone GroES
	SP_1906	groL	Heat shock protein 60 family chaperone GroEL
Position: -89 Score: 6.8 Sequence: AAAAATTTGACCTTTTTTGACCAA Locus tag: SP_0746 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	SP_0746	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD