Regulon of CtsR in Streptococcus mutans UA159

Properties
Regulator type:	Transcription factor
TF locus tag:	SMU.2030
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Streptococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 68 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -74 Score: 6.6 Sequence: TAAAGTTTGACCATTATTGACCAT Locus tag: SMU.562 Name: clpE Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
	SMU.562	clpE	ATP-dependent Clp protease, ATP-binding subunit ClpE
Position: -91 Score: 6.9 Sequence: TTTTTCTTGACTATTTTTGACCAA Locus tag: SMU.1955 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: SMU.1954 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	SMU.1955	groS	Heat shock protein 60 family co-chaperone GroES
	SMU.1954	groL	Heat shock protein 60 family chaperone GroEL
Position: -68 Score: 6.8 Sequence: AAATATTTGACCTTTTTTGACCAA Locus tag: SMU.1672 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	SMU.1672	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD