Regulon of CtsR in Streptococcus gordonii str. Challis substr. CH1

Properties
Regulator type:	Transcription factor
TF locus tag:	SGO_1999
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Streptococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 68 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -110 Score: 0.5 Sequence: TTAGTCAAAGATAGTCAATGTCAA Locus tag: SGO_1999 Name: ctsR Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family Locus tag: SGO_1998 Name: clpC Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
	SGO_1999	ctsR	Stress and heat shock response transcriptional regulator CtsR, CtsR family
	SGO_1998	clpC	ATP-dependent Clp protease ATP-binding subunit ClpC
Position: -65 Score: 6.9 Sequence: TAAAGTTTGACTATTTTTGACCAA Locus tag: SGO_0688 Name: clpE Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
	SGO_0688	clpE	ATP-dependent Clp protease, ATP-binding subunit ClpE
Position: -96 Score: 6.9 Sequence: TTTTTCTTGACTATTTTTGACCAA Locus tag: SGO_1886 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: SGO_1885 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	SGO_1886	groS	Heat shock protein 60 family co-chaperone GroES
	SGO_1885	groL	Heat shock protein 60 family chaperone GroEL
Position: -103 Score: 6.6 Sequence: AAAAATTTGACCTTTATTGACCAA Locus tag: SGO_1632 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	SGO_1632	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD