Regulon of CtsR in Streptococcus gallolyticus UCN34

Properties
Regulator type:	Transcription factor
TF locus tag:	GALLO_2164
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Streptococcaceae
Statistics of regulated genes:
- Genes	7
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 68 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -65 Score: 5.7 Sequence: TGAAGTTTGACTATCTTTGACCTT Locus tag: GALLO_0612 Name: clpE Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
	GALLO_0612	clpE	ATP-dependent Clp protease, ATP-binding subunit ClpE
Position: -66 Score: -0.3 Sequence: ATAGTCAGTTATAGTCAAAGATAG Locus tag: GALLO_2164 Name: ctsR Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family Locus tag: GALLO_2163 Name: clpC Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
	GALLO_2164	ctsR	Stress and heat shock response transcriptional regulator CtsR, CtsR family
	GALLO_2163	clpC	ATP-dependent Clp protease ATP-binding subunit ClpC
Position: -134 Score: 6.8 Sequence: TTTTTCTTGACTATTTCTGACCAA Locus tag: GALLO_0124 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: GALLO_0125 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	GALLO_0124	groS	Heat shock protein 60 family co-chaperone GroES
	GALLO_0125	groL	Heat shock protein 60 family chaperone GroEL
Position: -190 Score: 6.6 Sequence: AAATATTTGACTTTTACTGACCAA Locus tag: GALLO_1249 Name: clpL Funciton: ATP-dependent Clp protease, ATP-binding subunit
	GALLO_1249	clpL	ATP-dependent Clp protease, ATP-binding subunit
Position: -127 Score: 7 Sequence: TTTTATTTGACCTTTTTTGACCAA Locus tag: GALLO_1763 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	GALLO_1763	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD