Regulon of CtsR in Streptococcus equi subsp. zooepidemicus MGCS10565

Properties
Regulator type:	Transcription factor
TF locus tag:	Sez_0139
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Streptococcaceae
Statistics of regulated genes:
- Genes	7
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 68 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -93 Score: 6.8 Sequence: TATCATTTGACCTTTTTTGACCAA Locus tag: Sez_1614 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	Sez_1614	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Position: -63 Score: 6.7 Sequence: TAAAGTTTGACCATTTTTGACTAA Locus tag: Sez_0605 Name: clpE Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
	Sez_0605	clpE	ATP-dependent Clp protease, ATP-binding subunit ClpE
Position: -69 Score: 0.8 Sequence: TTAGTCAGTTTTAGTCAAAAATAA Locus tag: Sez_0139 Name: ctsR Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family Locus tag: Sez_0140 Name: clpC Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
	Sez_0139	ctsR	Stress and heat shock response transcriptional regulator CtsR, CtsR family
	Sez_0140	clpC	ATP-dependent Clp protease ATP-binding subunit ClpC
Position: -110 Score: 6.9 Sequence: TTTTTCTTGACTATTTTTGACCAA Locus tag: Sez_0145 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Sez_0146 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Sez_0145	groS	Heat shock protein 60 family co-chaperone GroES
	Sez_0146	groL	Heat shock protein 60 family chaperone GroEL
Position: -181 Score: 6.3 Sequence: TTTTGTTTGACCTTTACTGACCTT Locus tag: Sez_1072 Name: clpL Funciton: ATP-dependent Clp protease, ATP-binding subunit
	Sez_1072	clpL	ATP-dependent Clp protease, ATP-binding subunit

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD