Regulon of CtsR in Streptococcus dysgalactiae subsp. equisimilis GGS_124

Properties
Regulator type:	Transcription factor
TF locus tag:	SDEG_2043
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Streptococcaceae
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 68 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -125 Score: 6.5 Sequence: TATCATTTGACCTTTCTTGACCAA Locus tag: SDEG_0439 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	SDEG_0439	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Position: -62 Score: 6.7 Sequence: TAAAGTTTGACCATTTTTGACTAA Locus tag: SDEG_1496 Name: clpE Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
	SDEG_1496	clpE	ATP-dependent Clp protease, ATP-binding subunit ClpE
Position: -106 Score: 6.9 Sequence: TTTTTCTTGACTATTTTTGACCAA Locus tag: SDEG_2041 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: SDEG_2040 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	SDEG_2041	groS	Heat shock protein 60 family co-chaperone GroES
	SDEG_2040	groL	Heat shock protein 60 family chaperone GroEL
Position: -180 Score: 6.4 Sequence: TTTTGTTTGACCTTAACTGACCAA Locus tag: SDEG_0851 Name: clpL Funciton: ATP-dependent Clp protease, ATP-binding subunit
	SDEG_0851	clpL	ATP-dependent Clp protease, ATP-binding subunit

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD