Regulon of CtsR in Streptococcus agalactiae 2603V/R

Properties
Regulator type:	Transcription factor
TF locus tag:	SAG1829
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Streptococcaceae
Statistics of regulated genes:
- Genes	7
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 68 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 6.6 Sequence: TATTATTTGACCTTTGTTGACCAA Locus tag: SAG1585 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	SAG1585	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Position: -65 Score: 6.3 Sequence: TAAAGTTTGACTATATTTGACTAT Locus tag: SAG0488 Name: clpE Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
	SAG0488	clpE	ATP-dependent Clp protease, ATP-binding subunit ClpE
Position: -36 Score: -0.7 Sequence: ATAGTCAGTTATAGTCAAAGAGGA Locus tag: SAG1829 Name: ctsR Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family Locus tag: SAG1828 Name: clpC Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
	SAG1829	ctsR	Stress and heat shock response transcriptional regulator CtsR, CtsR family
	SAG1828	clpC	ATP-dependent Clp protease ATP-binding subunit ClpC
Position: -109 Score: 6.3 Sequence: TTTCTCTTGACTAATTCTGACCAA Locus tag: SAG2075 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: SAG2074 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	SAG2075	groS	Heat shock protein 60 family co-chaperone GroES
	SAG2074	groL	Heat shock protein 60 family chaperone GroEL
Position: -144 Score: 6.3 Sequence: TATTTATTGACCTTTACTGACTAA Locus tag: SAG1303 Name: clpL Funciton: ATP-dependent Clp protease, ATP-binding subunit
	SAG1303	clpL	ATP-dependent Clp protease, ATP-binding subunit

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD