Regulon of CtsR in Lactococcus lactis subsp. cremoris SK11

Properties
Regulator type:	Transcription factor
TF locus tag:	LACR_0665
Regulator family:	CtsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	CtsR - Streptococcaceae
Statistics of regulated genes:
- Genes	8
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 68 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CtsR
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -95 Score: 5.9 Sequence: TTTCTCTTGACTAAATCTGACCAT Locus tag: LACR_0439 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: LACR_0440 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	LACR_0439	groS	Heat shock protein 60 family co-chaperone GroES
	LACR_0440	groL	Heat shock protein 60 family chaperone GroEL
Position: -119 Score: -0.4 Sequence: ATGGTCAAATATGGTCAAGCTTTT Locus tag: LACR_0577 Name: yffA Funciton: Hypothetical protein Locus tag: LACR_0578 Name: clpE Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
	LACR_0577	yffA	Hypothetical protein
	LACR_0578	clpE	ATP-dependent Clp protease, ATP-binding subunit ClpE
Position: -110 Score: 6.8 Sequence: TTTTCTTTGACCTTTTTTGACCAA Locus tag: LACR_0700 Name: clpP Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
	LACR_0700	clpP	ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Position: -56 Score: 0.4 Sequence: ATAGTCAGTAATAGTCAAAGATTA Locus tag: LACR_0665 Name: ctsR Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family Locus tag: LACR_0666 Name: clpC Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
	LACR_0665	ctsR	Stress and heat shock response transcriptional regulator CtsR, CtsR family
	LACR_0666	clpC	ATP-dependent Clp protease ATP-binding subunit ClpC
Position: -98 Score: 6.3 Sequence: AAAAGCTTGACCATTACTGACTAA Locus tag: LACR_1612 Name: clpB Funciton: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
	LACR_1612	clpB	ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD