Regulon of FucR in Bacteroides vulgatus ATCC 8482

Properties
Regulator type:	Transcription factor
TF locus tag:	BVU_1374
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Fucose utilization
Effector:	Fucose
Regulog:	FucR - Bacteroidaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - GntR/Others
By effector - Fucose
By pathway - Fucose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 6.2 Sequence: CTTTGCATCGGGACAGTTCAGCACAG Locus tag: BVU_1374 Name: fucR Funciton: Transcriptional regulator of fucose utilization, GntR family Locus tag: BVU_1373 Name: fucI Funciton: L-fucose isomerase (EC 5.3.1.25) Locus tag: BVU_1372 Name: fucP Funciton: L-fucose permease
	BVU_1374	fucR	Transcriptional regulator of fucose utilization, GntR family
	BVU_1373	fucI	L-fucose isomerase (EC 5.3.1.25)
	BVU_1372	fucP	L-fucose permease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD