Regulon of FucR in Bacteroides thetaiotaomicron VPI-5482

Properties
Regulator type:	Transcription factor
TF locus tag:	BT1272
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Fucose utilization
Effector:	Fucose
Regulog:	FucR - Bacteroidaceae
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - GntR/Others
By effector - Fucose
By pathway - Fucose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -45 Score: 6.4 Sequence: CTTTGCAACAGCATAGCTCAGCACAG Locus tag: BT1272 Name: fucR Funciton: Transcriptional regulator of fucose utilization, GntR family Locus tag: BT1273 Name: fucI Funciton: L-fucose isomerase (EC 5.3.1.25) Locus tag: BT1274 Name: fucA Funciton: L-fuculose phosphate aldolase (EC 4.1.2.17) Locus tag: BT1275 Name: fucK Funciton: L-fuculokinase (EC 2.7.1.51) Locus tag: BT1276 Name: fucU Funciton: Possible alternative L-fucose mutarotase Locus tag: BT1277 Name: fucP Funciton: L-fucose permease
	BT1272	fucR	Transcriptional regulator of fucose utilization, GntR family
	BT1273	fucI	L-fucose isomerase (EC 5.3.1.25)
	BT1274	fucA	L-fuculose phosphate aldolase (EC 4.1.2.17)
	BT1275	fucK	L-fuculokinase (EC 2.7.1.51)
	BT1276	fucU	Possible alternative L-fucose mutarotase
	BT1277	fucP	L-fucose permease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD