Regulon of FucR in Bacteroides cellulosilyticus DSM 14838

Properties
Regulator type:	Transcription factor
TF locus tag:	BACCELL_04988
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Fucose utilization
Effector:	Fucose
Regulog:	FucR - Bacteroidaceae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - GntR/Others
By effector - Fucose
By pathway - Fucose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -69 Score: 6.3 Sequence: CTTTGCACCAGCACAGTTCAGCACAG Locus tag: BACCELL_04988 Name: fucR Funciton: Transcriptional regulator of fucose utilization, GntR family
	BACCELL_04988	fucR	Transcriptional regulator of fucose utilization, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD