Regulon of MtlR in Lactococcus lactis subsp. lactis Il1403

Properties
Regulator type:	Transcription factor
TF locus tag:	L30901
Regulator family:	BglG
Regulation mode:	activator
Biological process:	Mannitol utilization
Effector:	MtlA, mannitol-specific enzyme IICB PTS component; HPr, phosphocarrier protein
Regulog:	MtlR - Streptococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - BglG
By effector - MtlA, mannitol-specific enzyme IICB PTS component
By effector - HPr, phosphocarrier protein
By pathway - Mannitol utilization

Regulated operons
	Locus Tag	Name	Function
Position: -550 Score: 6.5 Sequence: TCTGACACAATTGTTGTGACACA Locus tag: L30901 Name: mtlR Funciton: Mannitol utilization transcription activator MtlR, BglG family Locus tag: L32907 Name: mtlF Funciton: PTS system, mannitol-specific IIA component (EC 2.7.1.69) Locus tag: L33416 Name: mtlD Funciton: Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17)
	L30901	mtlR	Mannitol utilization transcription activator MtlR, BglG family
	L32907	mtlF	PTS system, mannitol-specific IIA component (EC 2.7.1.69)
	L33416	mtlD	Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD