Regulon of CelR in Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Properties
Regulator type:	Transcription factor
TF locus tag:	LEUM_0929
Regulator family:	BglG
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Regulog:	CelR - Lactobacillaceae
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - BglG
By effector - CelB, cellobiose-specific PTS component EIIB
By effector - HPr, phosphocarrier protein
By pathway - Cellobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -83 Score: 6.8 Sequence: TTTCCGCAAGTATGAGGAAA Locus tag: LEUM_0927 Name: bglA Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86) Locus tag: LEUM_0928 Name: celB Funciton: Cellobiose-specific PTS, component EIIB Locus tag: LEUM_0929 Name: celR Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family Locus tag: LEUM_0930 Name: celA Funciton: Cellobiose-specific PTS, component EIIA Locus tag: LEUM_0931 Name: LEUM_0931 Funciton: Conserved hypothetical protein Locus tag: LEUM_0932 Name: celD Funciton: Cellobiose-specific PTS, component EIIC
	LEUM_0927	bglA	6-phospho-beta-glucosidase (EC 3.2.1.86)
	LEUM_0928	celB	Cellobiose-specific PTS, component EIIB
	LEUM_0929	celR	Cellobiose utilization transcriptional regulator CelR, BglG family
	LEUM_0930	celA	Cellobiose-specific PTS, component EIIA
	LEUM_0931	LEUM_0931	Conserved hypothetical protein
	LEUM_0932	celD	Cellobiose-specific PTS, component EIIC

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD