Regulog CelR - Lactobacillaceae

Properties
Regulator type:	Transcription factor
Regulator family:	BglG
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - BglG
By effector - CelB, cellobiose-specific PTS component EIIB
By effector - HPr, phosphocarrier protein
By pathway - Cellobiose utilization

Statistics of regulated genes
Genome	Genes	Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367
Lactobacillus casei ATCC 334
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG
Lactobacillus sakei subsp. sakei 23K
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	6	1
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
bglA	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367 Gene: LVIS_0465: 6-phospho-beta-glucosidase (EC 3.2.1.86)	Lactobacillus casei ATCC 334 Gene: LSEI_1778: 6-phospho-beta-glucosidase (EC 3.2.1.86)	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG Gene: LGG_00163: 6-phospho-beta-glucosidase (EC 3.2.1.86)	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	* Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Site: position = -83 score = 6.83644 sequence = TTTCCGCAAGTATGAGGAAA Gene: LEUM_0927: 6-phospho-beta-glucosidase (EC 3.2.1.86)	Oenococcus oeni PSU-1 Gene: OEOE_0224: 6-phospho-beta-glucosidase (EC 3.2.1.86)	Pediococcus pentosaceus ATCC 25745	6-phospho-beta-glucosidase (EC 3.2.1.86)
celB	Lactobacillus acidophilus NCFM Gene: LBA0876: Cellobiose-specific PTS, component EIIB	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334 Gene: LSEI_1782: Cellobiose-specific PTS, component EIIB	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG Gene: LGG_00159: Cellobiose-specific PTS, component EIIB	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_0928: Cellobiose-specific PTS, component EIIB	Oenococcus oeni PSU-1 Gene: OEOE_0223: Cellobiose-specific PTS, component EIIB	Pediococcus pentosaceus ATCC 25745	Cellobiose-specific PTS, component EIIB
celR	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_0929: Cellobiose utilization transcriptional regulator CelR, BglG family	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Cellobiose utilization transcriptional regulator CelR, BglG family
celA	Lactobacillus acidophilus NCFM Gene: LBA0877: Cellobiose-specific PTS, component EIIA	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334 Gene: LSEI_1781: Cellobiose-specific PTS, component EIIA	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG Gene: LGG_00160: Cellobiose-specific PTS, component EIIA	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_0930: Cellobiose-specific PTS, component EIIA	Oenococcus oeni PSU-1 Gene: OEOE_0222: Cellobiose-specific PTS, component EIIA	Pediococcus pentosaceus ATCC 25745	Cellobiose-specific PTS, component EIIA
LEUM_0931	Lactobacillus acidophilus NCFM Gene: LBA0878: Conserved hypothetical protein	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334 Gene: LSEI_1780: Conserved hypothetical protein	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533 Gene: LJ0183: Conserved hypothetical protein	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG Gene: LGG_00161: Conserved hypothetical protein	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_0931: Conserved hypothetical protein	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Conserved hypothetical protein
celD	Lactobacillus acidophilus NCFM Gene: LBA0879: Cellobiose-specific PTS, component EIIC	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533 Gene: LJ0184: Cellobiose-specific PTS, component EIIC	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG Gene: LGG_00162: Cellobiose-specific PTS, component EIIC	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_0932: Cellobiose-specific PTS, component EIIC	Oenococcus oeni PSU-1 Gene: OEOE_0221: Cellobiose-specific PTS, component EIIC	Pediococcus pentosaceus ATCC 25745	Cellobiose-specific PTS, component EIIC

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog CelR - Lactobacillaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --