Regulog CelR - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | BglG |
| Regulation mode: | repressor |
| Biological process: | Cellobiose utilization |
| Effector: | CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - BglG
- By effector - CelB, cellobiose-specific PTS component EIIB
- By effector - HPr, phosphocarrier protein
- By pathway - Cellobiose utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | ||
| Lactobacillus brevis ATCC 367 | ||
| Lactobacillus casei ATCC 334 | ||
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
| Lactobacillus fermentum IFO 3956 | ||
| Lactobacillus helveticus DPC 4571 | ||
| Lactobacillus johnsonii NCC 533 | ||
| Lactobacillus plantarum WCFS1 | ||
| Lactobacillus reuteri JCM 1112 | ||
| Lactobacillus rhamnosus GG | ||
| Lactobacillus sakei subsp. sakei 23K | ||
| Lactobacillus salivarius subsp. salivarius UCC118 | ||
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | 6 | 1 |
| Oenococcus oeni PSU-1 | ||
| Pediococcus pentosaceus ATCC 25745 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| bglA |
|
Gene: LVIS_0465: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
Gene: LSEI_1778: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
|
|
|
|
|
|
Gene: LGG_00163: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
|
|
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Site: position = -83 score = 6.83644 sequence = TTTCCGCAAGTATGAGGAAA Gene: LEUM_0927: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
Gene: OEOE_0224: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
|
6-phospho-beta-glucosidase (EC 3.2.1.86) |
| celB |
Gene: LBA0876: Cellobiose-specific PTS, component EIIB |
|
Gene: LSEI_1782: Cellobiose-specific PTS, component EIIB |
|
|
|
|
|
|
Gene: LGG_00159: Cellobiose-specific PTS, component EIIB |
|
|
Gene: LEUM_0928: Cellobiose-specific PTS, component EIIB |
Gene: OEOE_0223: Cellobiose-specific PTS, component EIIB |
|
Cellobiose-specific PTS, component EIIB |
| celR |
|
|
|
|
|
|
|
|
|
|
|
|
Gene: LEUM_0929: Cellobiose utilization transcriptional regulator CelR, BglG family |
|
|
Cellobiose utilization transcriptional regulator CelR, BglG family |
| celA |
Gene: LBA0877: Cellobiose-specific PTS, component EIIA |
|
Gene: LSEI_1781: Cellobiose-specific PTS, component EIIA |
|
|
|
|
|
|
Gene: LGG_00160: Cellobiose-specific PTS, component EIIA |
|
|
Gene: LEUM_0930: Cellobiose-specific PTS, component EIIA |
Gene: OEOE_0222: Cellobiose-specific PTS, component EIIA |
|
Cellobiose-specific PTS, component EIIA |
| LEUM_0931 |
Gene: LBA0878: Conserved hypothetical protein |
|
Gene: LSEI_1780: Conserved hypothetical protein |
|
|
|
Gene: LJ0183: Conserved hypothetical protein |
|
|
Gene: LGG_00161: Conserved hypothetical protein |
|
|
Gene: LEUM_0931: Conserved hypothetical protein |
|
|
Conserved hypothetical protein |
| celD |
Gene: LBA0879: Cellobiose-specific PTS, component EIIC |
|
|
|
|
|
Gene: LJ0184: Cellobiose-specific PTS, component EIIC |
|
|
Gene: LGG_00162: Cellobiose-specific PTS, component EIIC |
|
|
Gene: LEUM_0932: Cellobiose-specific PTS, component EIIC |
Gene: OEOE_0221: Cellobiose-specific PTS, component EIIC |
|
Cellobiose-specific PTS, component EIIC |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |