Regulon of SdaR in Lactobacillus sakei subsp. sakei 23K

Properties
Regulator type:	Transcription factor
TF locus tag:	LSA0710
Regulator family:	SdaR
Regulation mode:	repressor
Biological process:	Glycerate utilization
Effector:	D-glycerate
Regulog:	SdaR - Lactobacillaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - SdaR
By TF family - SdaR
By effector - D-glycerate
By pathway - Glycerate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -38 Score: 4.9 Sequence: GATTGTGTTATATAACAAAA Locus tag: LSA0711 Name: grtP Funciton: D-glycerate transporter, GntP family Locus tag: LSA0712 Name: garK Funciton: Glycerate kinase (EC 2.7.1.31)
	LSA0711	grtP	D-glycerate transporter, GntP family
	LSA0712	garK	Glycerate kinase (EC 2.7.1.31)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD