Regulon of LSEI_0368 in Lactobacillus rhamnosus GG

Properties
Regulator type:	Transcription factor
TF locus tag:	LGG_00419
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	LSEI_0368 - Lactobacillaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -141 Score: 6.5 Sequence: GTGCGAAAACGTTTACACAA Position: -43 Score: 6.7 Sequence: TTGCGTAAACGTTACCGCAA Locus tag: LGG_00418 Name: tal Funciton: Transaldolase (EC 2.2.1.2) Locus tag: LGG_00417 Name: LSEI_0366 Funciton: Predicted PTS, EIICD component (EC 2.7.1.69), similar to mannose PTS Locus tag: LGG_00416 Name: LGG_00416 Funciton: Predicted PTS, EIIA component Locus tag: LGG_00415 Name: LGG_00415 Funciton: Predicted PTS, EIIB component
	LGG_00418	tal	Transaldolase (EC 2.2.1.2)
	LGG_00417	LSEI_0366	Predicted PTS, EIICD component (EC 2.7.1.69), similar to mannose PTS
	LGG_00416	LGG_00416	Predicted PTS, EIIA component
	LGG_00415	LGG_00415	Predicted PTS, EIIB component
Position: -180 Score: 6.7 Sequence: TTGCGGTAACGTTTACGCAA Position: -82 Score: 6.5 Sequence: TTGTGTAAACGTTTTCGCAC Locus tag: LGG_00419 Name: LSEI_0368 Funciton: Predicted sugar utilization transcriptional regulator, LacI family
	LGG_00419	LSEI_0368	Predicted sugar utilization transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD