Regulog LSEI_0368 - Lactobacillaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By pathway - Sugar utilization

Statistics of regulated genes
Genome	Genes	Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367
Lactobacillus casei ATCC 334	3	2
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG	5	2
Lactobacillus sakei subsp. sakei 23K
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
LSEI_0368	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367	* Lactobacillus casei ATCC 334 Site: position = -71 score = 6.4612 sequence = TTGTGTAAACGTTTTCGCAT Site: position = -169 score = 6.72384 sequence = TTGCGGTAACGTTTACGCAA Gene: LSEI_0368 : Predicted sugar utilization transcriptional regulator, LacI family	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112	* Lactobacillus rhamnosus GG Site: position = -82 score = 6.4612 sequence = TTGTGTAAACGTTTTCGCAC Site: position = -180 score = 6.72384 sequence = TTGCGGTAACGTTTACGCAA Gene: LGG_00419: Predicted sugar utilization transcriptional regulator, LacI family	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Predicted sugar utilization transcriptional regulator, LacI family

CRON 2.
tal	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367 Gene: LVIS_0764: Transaldolase (EC 2.2.1.2)	* Lactobacillus casei ATCC 334 Site: position = -44 score = 6.72384 sequence = TTGCGTAAACGTTACCGCAA Site: position = -142 score = 6.4612 sequence = ATGCGAAAACGTTTACACAA Gene: LSEI_0367: Transaldolase (EC 2.2.1.2)	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956 Gene: LAF_1722: Transaldolase (EC 2.2.1.2)	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112	* Lactobacillus rhamnosus GG Site: position = -141 score = 6.4612 sequence = GTGCGAAAACGTTTACACAA Site: position = -43 score = 6.72384 sequence = TTGCGTAAACGTTACCGCAA Gene: LGG_00418: Transaldolase (EC 2.2.1.2)	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Transaldolase (EC 2.2.1.2)
LSEI_0366	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334 Gene: LSEI_0366: Predicted PTS, EIICD component (EC 2.7.1.69), similar to mannose PTS	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG Gene: LGG_00417: Predicted PTS, EIICD component (EC 2.7.1.69), similar to mannose PTS	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Predicted PTS, EIICD component (EC 2.7.1.69), similar to mannose PTS
LGG_00416	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG Gene: LGG_00416: Predicted PTS, EIIA component	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Predicted PTS, EIIA component
LGG_00415	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG Gene: LGG_00415: Predicted PTS, EIIB component	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Predicted PTS, EIIB component

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog LSEI_0368 - Lactobacillaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --