Regulon of AlsR in Lactococcus lactis subsp. cremoris SK11

Properties
Regulator type:	Transcription factor
TF locus tag:	LACR_1640
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Allose utilization
Effector:	Allose-6-phosphate
Regulog:	AlsR - Streptococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By effector - Allose-6-phosphate
By pathway - Allose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -182 Score: 6.5 Sequence: TTGAGATAACGATTACCCAA Locus tag: LACR_1640 Name: alsR Funciton: Transcriptional regulator of D-allose utilization, LacI family
	LACR_1640	alsR	Transcriptional regulator of D-allose utilization, LacI family
Position: -31 Score: 6.5 Sequence: TTGGGTAATCGTTATCTCAA Locus tag: LACR_1639 Name: alsE Funciton: D-allulose-6-phosphate 3-epimerase (EC 5.1.3.-) Locus tag: LACR_1638 Name: alsI Funciton: D-allose-6-phosphate isomerase (EC 5.3.1.-) Locus tag: LACR_1637 Name: bglH Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
	LACR_1639	alsE	D-allulose-6-phosphate 3-epimerase (EC 5.1.3.-)
	LACR_1638	alsI	D-allose-6-phosphate isomerase (EC 5.3.1.-)
	LACR_1637	bglH	6-phospho-beta-glucosidase (EC 3.2.1.86)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD