Profile of regulator AlsR in Streptococcaceae
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Allose utilization |
| Effector: | Allose-6-phosphate |
| Regulog: | AlsR - Streptococcaceae |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - LacI
- By effector - Allose-6-phosphate
- By pathway - Allose utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Lactococcus lactis subsp. cremoris SK11 | |||||
| LACR_1639 | alsE | -31 | 6.5 | TTGGGTAATCGTTATCTCAA | |
| LACR_1640 | alsR | -182 | 6.5 | TTGAGATAACGATTACCCAA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |