Regulon of NigR in Lactobacillus salivarius subsp. salivarius UCC118

Properties
Regulator type:	Transcription factor
TF locus tag:	LSL_1711
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Nigerose utilization
Effector:	Nigerose-6-phosphate
Regulog:	NigR - Lactobacillaceae
Statistics of regulated genes:
- Genes	12
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By effector - Nigerose-6-phosphate
By pathway - Nigerose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -86 Score: 7 Sequence: AACTTGAAACGTTTAAAGTT Locus tag: LSL_1716 Name: nigB Funciton: Nigerose -specific PTS system, EIIB component Locus tag: LSL_1715 Name: nigC Funciton: Nigerose-specific PTS system, EIIC component Locus tag: LSL_1714 Name: nigD Funciton: Nigerose-specific PTS system, EIID component Locus tag: LSL_1713 Name: nigA Funciton: Nigerose-specific PTS system, EIIA component Locus tag: LSL_1712 Name: ogl Funciton: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase Locus tag: LSL_1711 Name: nigR Funciton: Nigerose utilization regulator, LacI family
	LSL_1716	nigB	Nigerose -specific PTS system, EIIB component
	LSL_1715	nigC	Nigerose-specific PTS system, EIIC component
	LSL_1714	nigD	Nigerose-specific PTS system, EIID component
	LSL_1713	nigA	Nigerose-specific PTS system, EIIA component
	LSL_1712	ogl	Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase
	LSL_1711	nigR	Nigerose utilization regulator, LacI family
Position: -86 Score: 7 Sequence: AACTTGAAACGTTTAAAGTT Locus tag: LSL_1716 Name: nigB Funciton: Nigerose-specific PTS system, EIIB component Locus tag: LSL_1715 Name: nigC Funciton: Nigerose-specific PTS system, EIIC component Locus tag: LSL_1714 Name: nigD Funciton: Nigerose-specific PTS system, EIID component Locus tag: LSL_1713 Name: nigA Funciton: Nigerose-specific PTS system, EIIA component Locus tag: LSL_1712 Name: ogl Funciton: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase Locus tag: LSL_1711 Name: nigR Funciton: Nigerose utilization repressor, LacI family
	LSL_1716	nigB	Nigerose-specific PTS system, EIIB component
	LSL_1715	nigC	Nigerose-specific PTS system, EIIC component
	LSL_1714	nigD	Nigerose-specific PTS system, EIID component
	LSL_1713	nigA	Nigerose-specific PTS system, EIIA component
	LSL_1712	ogl	Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase
	LSL_1711	nigR	Nigerose utilization repressor, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD