Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulog NigR - Lactobacillaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Nigerose utilization
Effector: Nigerose-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367
Lactobacillus casei ATCC 334
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533 12 2
Lactobacillus plantarum WCFS1
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG
Lactobacillus sakei subsp. sakei 23K
Lactobacillus salivarius subsp. salivarius UCC118 12 2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nigB
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_0401: Nigerose -specific PTS system, EIIB component
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
*
Lactobacillus johnsonii NCC 533

Site:
position = -101
score = 6.85964
sequence = AACTTAAAACGTTTCAAGTT

Gene: LJ0739: Nigerose -specific PTS system, EIIB component
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -86
score = 6.9577
sequence = AACTTGAAACGTTTAAAGTT

Gene: LSL_1716: Nigerose -specific PTS system, EIIB component
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Nigerose -specific PTS system, EIIB component
nigC
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_0402: Nigerose-specific PTS system, EIIC component
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0740: Nigerose-specific PTS system, EIIC component
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1715: Nigerose-specific PTS system, EIIC component
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Nigerose-specific PTS system, EIIC component
nigD
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_0403: Nigerose-specific PTS system, EIID component
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0741: Nigerose-specific PTS system, EIID component
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1714: Nigerose-specific PTS system, EIID component
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Nigerose-specific PTS system, EIID component
nigA
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_0405: Nigerose-specific PTS system, EIIA component
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0742: Nigerose-specific PTS system, EIIA component
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1713: Nigerose-specific PTS system, EIIA component
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Nigerose-specific PTS system, EIIA component
ogl
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_0406: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0743: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1712: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase
nigR
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0744: Nigerose utilization regulator, LacI family
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1711: Nigerose utilization regulator, LacI family
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Nigerose utilization regulator, LacI family
 
CRON 2.
nigB
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_0401: Nigerose-specific PTS system, EIIB component
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
*
Lactobacillus johnsonii NCC 533

Site:
position = -35
score = 5.0237
sequence = TATTTAAAACGTTTAGATTT

Site:
position = -101
score = 6.85964
sequence = AACTTAAAACGTTTCAAGTT

Gene: LJ0739: Nigerose-specific PTS system, EIIB component
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
*
Lactobacillus salivarius subsp. salivarius UCC118

Site:
position = -86
score = 6.9577
sequence = AACTTGAAACGTTTAAAGTT

Gene: LSL_1716: Nigerose-specific PTS system, EIIB component
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Nigerose-specific PTS system, EIIB component
nigC
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_0402: Nigerose-specific PTS system, EIIC component
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0740: Nigerose-specific PTS system, EIIC component
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1715: Nigerose-specific PTS system, EIIC component
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Nigerose-specific PTS system, EIIC component
nigD
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_0403: Nigerose-specific PTS system, EIID component
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0741: Nigerose-specific PTS system, EIID component
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1714: Nigerose-specific PTS system, EIID component
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Nigerose-specific PTS system, EIID component
nigA
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_0405: Nigerose-specific PTS system, EIIA component
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0742: Nigerose-specific PTS system, EIIA component
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1713: Nigerose-specific PTS system, EIIA component
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Nigerose-specific PTS system, EIIA component
ogl
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334

Gene: LSEI_0406: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0743: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1712: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase
nigR
 
Lactobacillus acidophilus NCFM
 
Lactobacillus brevis ATCC 367
 
Lactobacillus casei ATCC 334
 
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
 
Lactobacillus fermentum IFO 3956
 
Lactobacillus helveticus DPC 4571
 
Lactobacillus johnsonii NCC 533

Gene: LJ0744: Nigerose utilization repressor, LacI family
 
Lactobacillus plantarum WCFS1
 
Lactobacillus reuteri JCM 1112
 
Lactobacillus rhamnosus GG
 
Lactobacillus sakei subsp. sakei 23K
 
Lactobacillus salivarius subsp. salivarius UCC118

Gene: LSL_1711: Nigerose utilization repressor, LacI family
 
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
 
Oenococcus oeni PSU-1
 
Pediococcus pentosaceus ATCC 25745
Nigerose utilization repressor, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD