Regulog NigR - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Nigerose utilization |
| Effector: | Nigerose-6-phosphate |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - LacI
- By effector - Nigerose-6-phosphate
- By pathway - Nigerose utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | ||
| Lactobacillus brevis ATCC 367 | ||
| Lactobacillus casei ATCC 334 | ||
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
| Lactobacillus fermentum IFO 3956 | ||
| Lactobacillus helveticus DPC 4571 | ||
| Lactobacillus johnsonii NCC 533 | 12 | 2 |
| Lactobacillus plantarum WCFS1 | ||
| Lactobacillus reuteri JCM 1112 | ||
| Lactobacillus rhamnosus GG | ||
| Lactobacillus sakei subsp. sakei 23K | ||
| Lactobacillus salivarius subsp. salivarius UCC118 | 12 | 2 |
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | ||
| Oenococcus oeni PSU-1 | ||
| Pediococcus pentosaceus ATCC 25745 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| nigB |
|
|
Gene: LSEI_0401: Nigerose -specific PTS system, EIIB component |
|
|
|
*
Lactobacillus johnsonii NCC 533 Site: position = -101 score = 6.85964 sequence = AACTTAAAACGTTTCAAGTT Gene: LJ0739: Nigerose -specific PTS system, EIIB component |
|
|
|
|
*
Lactobacillus salivarius subsp. salivarius UCC118 Site: position = -86 score = 6.9577 sequence = AACTTGAAACGTTTAAAGTT Gene: LSL_1716: Nigerose -specific PTS system, EIIB component |
|
|
|
Nigerose -specific PTS system, EIIB component |
| nigC |
|
|
Gene: LSEI_0402: Nigerose-specific PTS system, EIIC component |
|
|
|
Gene: LJ0740: Nigerose-specific PTS system, EIIC component |
|
|
|
|
Gene: LSL_1715: Nigerose-specific PTS system, EIIC component |
|
|
|
Nigerose-specific PTS system, EIIC component |
| nigD |
|
|
Gene: LSEI_0403: Nigerose-specific PTS system, EIID component |
|
|
|
Gene: LJ0741: Nigerose-specific PTS system, EIID component |
|
|
|
|
Gene: LSL_1714: Nigerose-specific PTS system, EIID component |
|
|
|
Nigerose-specific PTS system, EIID component |
| nigA |
|
|
Gene: LSEI_0405: Nigerose-specific PTS system, EIIA component |
|
|
|
Gene: LJ0742: Nigerose-specific PTS system, EIIA component |
|
|
|
|
Gene: LSL_1713: Nigerose-specific PTS system, EIIA component |
|
|
|
Nigerose-specific PTS system, EIIA component |
| ogl |
|
|
Gene: LSEI_0406: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase |
|
|
|
Gene: LJ0743: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase |
|
|
|
|
Gene: LSL_1712: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase |
|
|
|
Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase |
| nigR |
|
|
|
|
|
|
Gene: LJ0744: Nigerose utilization regulator, LacI family |
|
|
|
|
Gene: LSL_1711: Nigerose utilization regulator, LacI family |
|
|
|
Nigerose utilization regulator, LacI family |
| CRON 2. | ||||||||||||||||
| nigB |
|
|
Gene: LSEI_0401: Nigerose-specific PTS system, EIIB component |
|
|
|
*
Lactobacillus johnsonii NCC 533 Site: position = -35 score = 5.0237 sequence = TATTTAAAACGTTTAGATTT Site: position = -101 score = 6.85964 sequence = AACTTAAAACGTTTCAAGTT Gene: LJ0739: Nigerose-specific PTS system, EIIB component |
|
|
|
|
*
Lactobacillus salivarius subsp. salivarius UCC118 Site: position = -86 score = 6.9577 sequence = AACTTGAAACGTTTAAAGTT Gene: LSL_1716: Nigerose-specific PTS system, EIIB component |
|
|
|
Nigerose-specific PTS system, EIIB component |
| nigC |
|
|
Gene: LSEI_0402: Nigerose-specific PTS system, EIIC component |
|
|
|
Gene: LJ0740: Nigerose-specific PTS system, EIIC component |
|
|
|
|
Gene: LSL_1715: Nigerose-specific PTS system, EIIC component |
|
|
|
Nigerose-specific PTS system, EIIC component |
| nigD |
|
|
Gene: LSEI_0403: Nigerose-specific PTS system, EIID component |
|
|
|
Gene: LJ0741: Nigerose-specific PTS system, EIID component |
|
|
|
|
Gene: LSL_1714: Nigerose-specific PTS system, EIID component |
|
|
|
Nigerose-specific PTS system, EIID component |
| nigA |
|
|
Gene: LSEI_0405: Nigerose-specific PTS system, EIIA component |
|
|
|
Gene: LJ0742: Nigerose-specific PTS system, EIIA component |
|
|
|
|
Gene: LSL_1713: Nigerose-specific PTS system, EIIA component |
|
|
|
Nigerose-specific PTS system, EIIA component |
| ogl |
|
|
Gene: LSEI_0406: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase |
|
|
|
Gene: LJ0743: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase |
|
|
|
|
Gene: LSL_1712: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase |
|
|
|
Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase |
| nigR |
|
|
|
|
|
|
Gene: LJ0744: Nigerose utilization repressor, LacI family |
|
|
|
|
Gene: LSL_1711: Nigerose utilization repressor, LacI family |
|
|
|
Nigerose utilization repressor, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |