Regulon of RbsR2 in Lactococcus lactis subsp. lactis Il1403

Properties
Regulator type:	Transcription factor
TF locus tag:	L0145
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR2 - Streptococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 6.2 Sequence: TAATGAAAACGGATACAATT Locus tag: L0145 Name: rbsR2 Funciton: Transcriptional repressor of ribose utilization RbsR2, LacI family Locus tag: L86157 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: L85737 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: L84240 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: L83296 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: L82310 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
	L0145	rbsR2	Transcriptional repressor of ribose utilization RbsR2, LacI family
	L86157	rbsK	Ribokinase (EC 2.7.1.15)
	L85737	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	L84240	rbsA	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
	L83296	rbsC	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
	L82310	rbsB	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD