Regulog RbsR2 - Streptococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - LacI
- By effector - Ribose
- By pathway - Ribose utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactococcus lactis subsp. cremoris SK11 | 4 | 1 |
| Lactococcus lactis subsp. lactis Il1403 | 6 | 1 |
| Streptococcus agalactiae 2603V/R | 6 | 1 |
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | 5 | 1 |
| Streptococcus equi subsp. zooepidemicus MGCS10565 | 6 | 1 |
| Streptococcus gallolyticus UCN34 | ||
| Streptococcus gordonii str. Challis substr. CH1 | ||
| Streptococcus mitis B6 | ||
| Streptococcus mutans UA159 | ||
| Streptococcus pneumoniae TIGR4 | ||
| Streptococcus pyogenes M1 GAS | 1 | 1 |
| Streptococcus sanguinis SK36 | ||
| Streptococcus suis 05ZYH33 | ||
| Streptococcus thermophilus CNRZ1066 | ||
| Streptococcus uberis 0140J | 6 | 1 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| rbsR2 |
*
Lactococcus lactis subsp. cremoris SK11 Site: position = -66 score = 6.02234 sequence = AAATGAAAACGGATACAATC Gene: LACR_1803: Transcriptional repressor of ribose utilization RbsR2, LacI family |
*
Lactococcus lactis subsp. lactis Il1403 Site: position = -66 score = 6.20633 sequence = TAATGAAAACGGATACAATT Gene: L0145: Transcriptional repressor of ribose utilization RbsR2, LacI family |
*
Streptococcus agalactiae 2603V/R Site: position = -38 score = 5.37924 sequence = TTGTGAAACCGTTTCCACAA Gene: SAG0119: Transcriptional repressor of ribose utilization RbsR2, LacI family |
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -67 score = 6.04811 sequence = AAAAGAAAACGGTTACAACA Site: position = -43 score = 5.40656 sequence = ACGTGAGAACGGTTCCACAA Gene: SDEG_1537: Transcriptional repressor of ribose utilization RbsR2, LacI family |
*
Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -62 score = 6.27021 sequence = TTTAGAAAACGGTTACAATA Site: position = -39 score = 5.5586 sequence = ACATGAGAACGGTTCCACAA Gene: Sez_0468: Transcriptional repressor of ribose utilization RbsR2, LacI family |
|
|
|
|
|
*
Streptococcus pyogenes M1 GAS Site: position = -367 score = 3.69238 sequence = CATAAAAAACGGTTGAACCA Gene: SPy1535: Transcriptional repressor of ribose utilization RbsR2, LacI family |
|
|
|
*
Streptococcus uberis 0140J Site: position = -47 score = 6.67471 sequence = TAAAGAAAACGGTTACAATA Gene: SUB1312: Transcriptional repressor of ribose utilization RbsR2, LacI family |
Transcriptional repressor of ribose utilization RbsR2, LacI family |
| rbsK |
Gene: LACR_1802: Ribokinase (EC 2.7.1.15) |
Gene: L86157: Ribokinase (EC 2.7.1.15) |
Gene: SAG0118: Ribokinase (EC 2.7.1.15) |
Gene: SDEG_1536: Ribokinase (EC 2.7.1.15) |
Gene: Sez_0469: Ribokinase (EC 2.7.1.15) |
|
|
|
|
|
|
|
|
|
Gene: SUB1311: Ribokinase (EC 2.7.1.15) |
Ribokinase (EC 2.7.1.15) |
| rbsD |
Gene: LACR_1801: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: L85737: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: SAG0117: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: SDEG_1535: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: Sez_0470: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
|
|
|
|
|
|
|
|
|
Gene: SUB1310: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
| rbsA |
Gene: LACR_1800: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: L84240: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: SAG0116: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: SDEG_1534: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: Sez_0471: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
|
|
|
|
|
|
|
|
|
Gene: SUB1309: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
| rbsC |
|
Gene: L83296: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: SAG0115: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
|
Gene: Sez_0472: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
|
|
|
|
|
|
|
|
|
Gene: SUB1308: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
| rbsB |
|
Gene: L82310: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: SAG0114: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: SDEG_1533: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: Sez_0473: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
|
|
|
|
|
|
|
|
|
Gene: SUB1307: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |