Regulon of MntR in Corynebacterium urealyticum DSM 7109

Properties
Regulator type:	Transcription factor
TF locus tag:	cur_0586
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Corynebacteriaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -56 Score: 6.6 Sequence: AAGTTCAATACATTGAACTT Locus tag: cur_0526 Name: mtsB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: cur_0525 Name: mtsCA Funciton: Manganese ABC transporter, permease and substrate-binding protein
	cur_0526	mtsB	Manganese ABC transporter, ATP-binding protein
	cur_0525	mtsCA	Manganese ABC transporter, permease and substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD