Regulon of MntR in Corynebacterium kroppenstedtii DSM 44385

Properties
Regulator type:	Transcription factor
TF locus tag:	ckrop_1571
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Corynebacteriaceae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 5.6 Sequence: AAGTTCAAGCCATTGAATAA Locus tag: ckrop_3000 Name: nrdI2 Funciton: Ribonucleotide reduction protein NrdI Locus tag: ckrop_0016 Name: nrdF2 Funciton: Ribonucleoside-diphosphate reductase, beta subunit
	ckrop_3000	nrdI2	Ribonucleotide reduction protein NrdI
	ckrop_0016	nrdF2	Ribonucleoside-diphosphate reductase, beta subunit
Position: -143 Score: 5.7 Sequence: AAGTTCAATGCAATGTATTT Locus tag: ckrop_1571 Name: mntR Funciton: Mn-dependent transcriptional regulator MntR, DtxR family
	ckrop_1571	mntR	Mn-dependent transcriptional regulator MntR, DtxR family
Position: -177 Score: 5.9 Sequence: AAATACATTGCATTGAACTT Locus tag: ckrop_1572 Name: mtsA Funciton: Manganese ABC transporter, substrate-binding protein Locus tag: ckrop_1573 Name: mtsB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: ckrop_1574 Name: mtsC Funciton: Manganese ABC transporter, permease protein
	ckrop_1572	mtsA	Manganese ABC transporter, substrate-binding protein
	ckrop_1573	mtsB	Manganese ABC transporter, ATP-binding protein
	ckrop_1574	mtsC	Manganese ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD