Regulon of MntR in Corynebacterium diphtheriae NCTC 13129

Properties
Regulator type:	Transcription factor
TF locus tag:	DIP0619
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Corynebacteriaceae
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -81 Score: 6.7 Sequence: AAGTTCAATGCATTGAACTT Locus tag: DIP1923 Name: nrdI2 Funciton: Ribonucleotide reduction protein NrdI Locus tag: DIP1924 Name: nrdF2 Funciton: Ribonucleoside-diphosphate reductase, beta subunit
	DIP1923	nrdI2	Ribonucleotide reduction protein NrdI
	DIP1924	nrdF2	Ribonucleoside-diphosphate reductase, beta subunit
Position: -91 Score: 5.6 Sequence: AAATTCAATACGCTGAACAG Locus tag: DIP0615 Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein Locus tag: DIP0616 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: DIP0617 Name: mntC Funciton: Manganese ABC transporter, permease protein 1 Locus tag: DIP0618 Name: mntD Funciton: Manganese ABC transporter, permease protein 2 Locus tag: DIP0619 Name: mntR Funciton: Mn-dependent transcriptional regulator MntR, DtxR family
	DIP0615	mntA	Manganese ABC transporter, substrate-binding protein
	DIP0616	mntB	Manganese ABC transporter, ATP-binding protein
	DIP0617	mntC	Manganese ABC transporter, permease protein 1
	DIP0618	mntD	Manganese ABC transporter, permease protein 2
	DIP0619	mntR	Mn-dependent transcriptional regulator MntR, DtxR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD