Regulon of MntR in Corynebacterium aurimucosum ATCC 700975

Properties
Regulator type:	Transcription factor
TF locus tag:	cauri_0335
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Corynebacteriaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -51 Score: 6.7 Sequence: AAGTTCAATCCATTGAACAT Locus tag: cauri_0334 Name: mntM Funciton: Manganese ABC transporter, substrate-binding protein Locus tag: cauri_0333 Name: mntN Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: cauri_0332 Name: mntO Funciton: Manganese ABC transporter, permease protein 2 Locus tag: cauri_0331 Name: mntQ Funciton: Manganese ABC transporter, permease protein 2
	cauri_0334	mntM	Manganese ABC transporter, substrate-binding protein
	cauri_0333	mntN	Manganese ABC transporter, ATP-binding protein
	cauri_0332	mntO	Manganese ABC transporter, permease protein 2
	cauri_0331	mntQ	Manganese ABC transporter, permease protein 2
Position: -76 Score: 6.5 Sequence: ATGTTCAATGGATTGAACTT Locus tag: cauri_0335 Name: mntR Funciton: Mn-dependent transcriptional regulator MntR, DtxR family
	cauri_0335	mntR	Mn-dependent transcriptional regulator MntR, DtxR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD