Regulon of MntR in Corynebacterium amycolatum SK46

Properties
Regulator type:	Transcription factor
TF locus tag:	CORAM0001_0538
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Corynebacteriaceae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -153 Score: 6.1 Sequence: AAGTTCAATGGGTTGAAAAT Locus tag: CORAM0001_0534 Name: mntA Funciton: Manganese ABC transporter, substrate-binding protein Locus tag: CORAM0001_0535 Name: mntB Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: CORAM0001_0536 Name: mntC Funciton: Manganese ABC transporter, permease protein 1 Locus tag: CORAM0001_0537 Name: mntD Funciton: Manganese ABC transporter, permease protein 2 Locus tag: CORAM0001_0538 Name: mntR Funciton: Mn-dependent transcriptional regulator MntR, DtxR family
	CORAM0001_0534	mntA	Manganese ABC transporter, substrate-binding protein
	CORAM0001_0535	mntB	Manganese ABC transporter, ATP-binding protein
	CORAM0001_0536	mntC	Manganese ABC transporter, permease protein 1
	CORAM0001_0537	mntD	Manganese ABC transporter, permease protein 2
	CORAM0001_0538	mntR	Mn-dependent transcriptional regulator MntR, DtxR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD