Regulon of Zur2 in Neisseria meningitidis MC58

Properties
Regulator type:	Transcription factor
TF locus tag:	NMB1266
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur2 - Various betaproteobacteria
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By trascription factor - Zur
By taxonomy - Various betaproteobacteria
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 6.4 Sequence: GTAATGTTATATAATAACAAACT Locus tag: NMB0964 Name: omr Funciton: Predicted zinc-related TonB-dependent outer membrane transporter
	NMB0964	omr	Predicted zinc-related TonB-dependent outer membrane transporter
Position: -49 Score: 5.6 Sequence: GGCTTGTTTTACCATAACAGATG Locus tag: NMB0586 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	NMB0586	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -148 Score: 5.8 Sequence: CAAACGTTATACAGTATCATATC Locus tag: NMB0588 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: NMB0587 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	NMB0588	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	NMB0587	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD