Regulon of Zur2 in Laribacter hongkongensis HLHK9

Properties
Regulator type:	Transcription factor
TF locus tag:	LHK_01344
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur2 - Various betaproteobacteria
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By trascription factor - Zur
By taxonomy - Various betaproteobacteria
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 5.6 Sequence: GTTACGGCATAACATAACGAAAT Locus tag: LHK_01344 Name: zur2 Funciton: Zinc uptake regulation protein Zur Locus tag: LHK_01345 Name: yciC Funciton: Putative zinc chaperone, COG0523 family Locus tag: LHK_01346 Name: LHK_01346 Funciton: Hypothetical protein Locus tag: LHK_01347 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: LHK_01348 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: LHK_01349 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	LHK_01344	zur2	Zinc uptake regulation protein Zur
	LHK_01345	yciC	Putative zinc chaperone, COG0523 family
	LHK_01346	LHK_01346	Hypothetical protein
	LHK_01347	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	LHK_01348	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	LHK_01349	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD