Regulon of Zur2 in Chromobacterium violaceum ATCC 12472
| Regulator type: | Transcription factor |
| TF locus tag: | CV3068 |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Regulog: | Zur2 - Various betaproteobacteria |
| Statistics of regulated genes: | |
| - Genes | 5 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - Zur
- By taxonomy - Various betaproteobacteria
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -137
Score: 6.2 Sequence: GCGATGTTATACAGTAACATTAT
Locus tag: CV3068
Name: zur2 Funciton: Zinc uptake regulation protein Zur
Locus tag: CV3067
Name: yciC Funciton: Putative zinc chaperone, COG0523 family
Locus tag: CV3066
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: CV3065
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: CV3064
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|||
|
zur2
|
Zinc uptake regulation protein Zur
|
||
|
yciC
|
Putative zinc chaperone, COG0523 family
|
||
|
znuC
|
Zinc ABC transporter, ATP-binding protein ZnuC
|
||
|
znuB
|
Zinc ABC transporter, inner membrane permease protein ZnuB
|
||
|
znuA
|
Zinc ABC transporter, periplasmic-binding protein ZnuA
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |