Regulon of Cg1831 in Corynebacterium efficiens YS-314

Properties
Regulator type:	Transcription factor
TF locus tag:	CE2678
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:
Regulog:	Cg1831 - Corynebacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By TF family - ArsR
By pathway - Iron homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: 8 Score: 5.9 Sequence: ACTCAATCACCCGTTTGACT Locus tag: CE2678 Name: cg1831 Funciton: Predicted Fe-siderophore transport transcriptional regulator, MerR family
	CE2678	cg1831	Predicted Fe-siderophore transport transcriptional regulator, MerR family
Position: -34 Score: 5.9 Sequence: AGTCAAACGGGTGATTGAGT Locus tag: CE2677 Name: cg1832 Funciton: Predicted Fe-siderophore ABC transporter, permease protein Locus tag: CE2676 Name: cg1833 Funciton: Predicted Fe-siderophore ABC transporter, substrate-binding protein Locus tag: CE2675 Name: cg1834 Funciton: Predicted Fe-siderophore ABC transporter, ATP-binding protein
	CE2677	cg1832	Predicted Fe-siderophore ABC transporter, permease protein
	CE2676	cg1833	Predicted Fe-siderophore ABC transporter, substrate-binding protein
	CE2675	cg1834	Predicted Fe-siderophore ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD