Regulog Cg1831 - Corynebacteriaceae

Properties
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:
Phylum:	Actinobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By TF family - ArsR
By pathway - Iron homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Corynebacterium amycolatum SK46
Corynebacterium aurimucosum ATCC 700975
Corynebacterium diphtheriae NCTC 13129
Corynebacterium efficiens YS-314	4	2
Corynebacterium glutamicum ATCC 13032	4	2
Corynebacterium jeikeium K411
Corynebacterium kroppenstedtii DSM 44385
Corynebacterium urealyticum DSM 7109

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes									Function

CRON 1.
cg1832	Corynebacterium amycolatum SK46	Corynebacterium aurimucosum ATCC 700975	Corynebacterium diphtheriae NCTC 13129	* Corynebacterium efficiens YS-314 Site: position = -34 score = 5.94376 sequence = AGTCAAACGGGTGATTGAGT Gene: CE2677: Predicted Fe-siderophore ABC transporter, permease protein	* Corynebacterium glutamicum ATCC 13032 Site: position = -34 score = 6.52683 sequence = AGTCAAATGATCATTTGAGT Gene: cg1832: Predicted Fe-siderophore ABC transporter, permease protein	Corynebacterium jeikeium K411	Corynebacterium kroppenstedtii DSM 44385	Corynebacterium urealyticum DSM 7109	Predicted Fe-siderophore ABC transporter, permease protein
cg1833	Corynebacterium amycolatum SK46	Corynebacterium aurimucosum ATCC 700975	Corynebacterium diphtheriae NCTC 13129	Corynebacterium efficiens YS-314 Gene: CE2676: Predicted Fe-siderophore ABC transporter, substrate-binding protein	Corynebacterium glutamicum ATCC 13032 Gene: cg1833: Predicted Fe-siderophore ABC transporter, substrate-binding protein	Corynebacterium jeikeium K411	Corynebacterium kroppenstedtii DSM 44385	Corynebacterium urealyticum DSM 7109	Predicted Fe-siderophore ABC transporter, substrate-binding protein
cg1834	Corynebacterium amycolatum SK46	Corynebacterium aurimucosum ATCC 700975	Corynebacterium diphtheriae NCTC 13129	Corynebacterium efficiens YS-314 Gene: CE2675: Predicted Fe-siderophore ABC transporter, ATP-binding protein	Corynebacterium glutamicum ATCC 13032 Gene: cg1834: Predicted Fe-siderophore ABC transporter, ATP-binding protein	Corynebacterium jeikeium K411	Corynebacterium kroppenstedtii DSM 44385	Corynebacterium urealyticum DSM 7109	Predicted Fe-siderophore ABC transporter, ATP-binding protein

CRON 2.
cg1831	Corynebacterium amycolatum SK46	Corynebacterium aurimucosum ATCC 700975	Corynebacterium diphtheriae NCTC 13129	* Corynebacterium efficiens YS-314 Site: position = 8 score = 5.94376 sequence = ACTCAATCACCCGTTTGACT Gene: CE2678: Predicted Fe-siderophore transport transcriptional regulator, MerR family	* Corynebacterium glutamicum ATCC 13032 Site: position = -40 score = 6.52683 sequence = ACTCAAATGATCATTTGACT Gene: cg1831: Predicted Fe-siderophore transport transcriptional regulator, MerR family	Corynebacterium jeikeium K411	Corynebacterium kroppenstedtii DSM 44385	Corynebacterium urealyticum DSM 7109	Predicted Fe-siderophore transport transcriptional regulator, MerR family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Cg1831 - Corynebacteriaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --