Regulog Cg1831 - Corynebacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Iron homeostasis |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Corynebacteriaceae
- By TF family - ArsR
- By pathway - Iron homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Corynebacterium amycolatum SK46 | ||
| Corynebacterium aurimucosum ATCC 700975 | ||
| Corynebacterium diphtheriae NCTC 13129 | ||
| Corynebacterium efficiens YS-314 | 4 | 2 |
| Corynebacterium glutamicum ATCC 13032 | 4 | 2 |
| Corynebacterium jeikeium K411 | ||
| Corynebacterium kroppenstedtii DSM 44385 | ||
| Corynebacterium urealyticum DSM 7109 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| cg1832 |
|
|
|
*
Corynebacterium efficiens YS-314 Site: position = -34 score = 5.94376 sequence = AGTCAAACGGGTGATTGAGT Gene: CE2677: Predicted Fe-siderophore ABC transporter, permease protein |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -34 score = 6.52683 sequence = AGTCAAATGATCATTTGAGT Gene: cg1832: Predicted Fe-siderophore ABC transporter, permease protein |
|
|
|
Predicted Fe-siderophore ABC transporter, permease protein |
| cg1833 |
|
|
|
Gene: CE2676: Predicted Fe-siderophore ABC transporter, substrate-binding protein |
Gene: cg1833: Predicted Fe-siderophore ABC transporter, substrate-binding protein |
|
|
|
Predicted Fe-siderophore ABC transporter, substrate-binding protein |
| cg1834 |
|
|
|
Gene: CE2675: Predicted Fe-siderophore ABC transporter, ATP-binding protein |
Gene: cg1834: Predicted Fe-siderophore ABC transporter, ATP-binding protein |
|
|
|
Predicted Fe-siderophore ABC transporter, ATP-binding protein |
| CRON 2. | |||||||||
| cg1831 |
|
|
|
*
Corynebacterium efficiens YS-314 Site: position = 8 score = 5.94376 sequence = ACTCAATCACCCGTTTGACT Gene: CE2678: Predicted Fe-siderophore transport transcriptional regulator, MerR family |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -40 score = 6.52683 sequence = ACTCAAATGATCATTTGACT Gene: cg1831: Predicted Fe-siderophore transport transcriptional regulator, MerR family |
|
|
|
Predicted Fe-siderophore transport transcriptional regulator, MerR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |