Regulon of CitB in Corynebacterium glutamicum ATCC 13032

Properties
Regulator type:	Transcription factor
TF locus tag:	cg0090
Regulator family:	CitB
Regulation mode:	activator
Biological process:	Citrate utilization
Effector:	Citrate
Regulog:	CitB - Corynebacteriaceae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By TF family - CitB
By effector - Citrate
By pathway - Citrate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -148 Score: 5.7 Sequence: GATCATAATGCACAAAAGTC Locus tag: cg0088 Name: citH Funciton: Citrate transporter
	cg0088	citH	Citrate transporter
Position: -80 Score: 5.2 Sequence: GACTTTTGTGCATTATGATC Locus tag: cg0089 Name: citA Funciton: Citrate transport regulation two-component system histidine kinase Locus tag: cg0090 Name: citB Funciton: Citrate transport regulation two-component system response regulator, LuxR family
	cg0089	citA	Citrate transport regulation two-component system histidine kinase
	cg0090	citB	Citrate transport regulation two-component system response regulator, LuxR family
Position: -43 Score: 5.1 Sequence: GAGCTTGTTGTCCAAAAGTC Locus tag: cg3127 Name: tctC Funciton: Citrate TTT family transporter, subunit C Locus tag: cg3126 Name: tctB Funciton: Citrate TTT family transporter, subunit B Locus tag: cg3125 Name: tctA Funciton: Citrate TTT family transporter, subunit A
	cg3127	tctC	Citrate TTT family transporter, subunit C
	cg3126	tctB	Citrate TTT family transporter, subunit B
	cg3125	tctA	Citrate TTT family transporter, subunit A

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD