Regulog CitB - Corynebacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | CitB |
| Regulation mode: | activator |
| Biological process: | Citrate utilization |
| Effector: | Citrate |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Corynebacteriaceae
- By TF family - CitB
- By effector - Citrate
- By pathway - Citrate utilization
| Genome | Genes | Operons |
|---|---|---|
| Corynebacterium amycolatum SK46 | ||
| Corynebacterium aurimucosum ATCC 700975 | ||
| Corynebacterium diphtheriae NCTC 13129 | ||
| Corynebacterium efficiens YS-314 | 3 | 2 |
| Corynebacterium glutamicum ATCC 13032 | 6 | 3 |
| Corynebacterium jeikeium K411 | ||
| Corynebacterium kroppenstedtii DSM 44385 | ||
| Corynebacterium urealyticum DSM 7109 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| citH |
|
|
|
*
Corynebacterium efficiens YS-314 Site: position = -35 score = 6.00283 sequence = GAACTAAATGCACTTAATTC Gene: CE2906: Citrate transporter |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -148 score = 5.70863 sequence = GATCATAATGCACAAAAGTC Gene: cg0088: Citrate transporter |
|
|
|
Citrate transporter |
| CRON 2. | |||||||||
| citA |
|
|
|
*
Corynebacterium efficiens YS-314 Site: position = -81 score = 5.7749 sequence = GAATTAAGTGCATTTAGTTC Gene: CE2905: Citrate transport regulation two-component system histidine kinase |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -80 score = 5.24241 sequence = GACTTTTGTGCATTATGATC Gene: cg0089: Citrate transport regulation two-component system histidine kinase |
|
|
|
Citrate transport regulation two-component system histidine kinase |
| citB |
|
|
|
Gene: CE2904: Citrate transport regulation two-component system response regulator, LuxR family |
Gene: cg0090: Citrate transport regulation two-component system response regulator, LuxR family |
|
|
|
Citrate transport regulation two-component system response regulator, LuxR family |
| CRON 3. | |||||||||
| tctC |
|
|
|
|
*
Corynebacterium glutamicum ATCC 13032 Site: position = -43 score = 5.14334 sequence = GAGCTTGTTGTCCAAAAGTC Gene: cg3127: Citrate TTT family transporter, subunit C |
|
|
|
Citrate TTT family transporter, subunit C |
| tctB |
|
|
|
|
Gene: cg3126: Citrate TTT family transporter, subunit B |
|
|
|
Citrate TTT family transporter, subunit B |
| tctA |
|
|
|
|
Gene: cg3125: Citrate TTT family transporter, subunit A |
|
|
|
Citrate TTT family transporter, subunit A |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |