Regulon of ArsR in Corynebacterium urealyticum DSM 7109

Properties
Regulator type:	Transcription factor
TF locus tag:	cur_0030
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:	Arsenite; Arsenate
Regulog:	ArsR - Corynebacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By TF family - ArsR
By effector - Arsenite
By effector - Arsenate
By pathway - Arsenic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 6 Sequence: ATATTGATGGTCATCGATAC Position: -32 Score: 6.1 Sequence: ATATAGATGACCGTCAATAT Locus tag: cur_0030 Name: arsR Funciton: Arsenic resistance transcriptional regulator ArsR, ArsR family
	cur_0030	arsR	Arsenic resistance transcriptional regulator ArsR, ArsR family
Position: -68 Score: 6.1 Sequence: ATATTGACGGTCATCTATAT Position: -34 Score: 6 Sequence: GTATCGATGACCATCAATAT Locus tag: cur_0031 Name: arsB Funciton: Arsenite efflux membrane protein Locus tag: cur_0032 Name: arsC Funciton: Arsenate reductase (EC 1.20.4.1)
	cur_0031	arsB	Arsenite efflux membrane protein
	cur_0032	arsC	Arsenate reductase (EC 1.20.4.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD