Regulon of ArsR in Corynebacterium jeikeium K411

Properties
Regulator type:	Transcription factor
TF locus tag:	jk2006
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:	Arsenite; Arsenate
Regulog:	ArsR - Corynebacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By TF family - ArsR
By effector - Arsenite
By effector - Arsenate
By pathway - Arsenic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 6.4 Sequence: ATATTGATGCCTGTCAATAT Position: -32 Score: 6.3 Sequence: ATATTGATATCTGTCAATAT Locus tag: jk2006 Name: arsR Funciton: Arsenic resistance transcriptional regulator ArsR, ArsR family
	jk2006	arsR	Arsenic resistance transcriptional regulator ArsR, ArsR family
Position: -94 Score: 6.3 Sequence: ATATTGACAGATATCAATAT Position: -67 Score: 6.4 Sequence: ATATTGACAGGCATCAATAT Locus tag: jk2005 Name: arsB Funciton: Arsenite efflux membrane protein Locus tag: jk2004 Name: arsC Funciton: Arsenate reductase (EC 1.20.4.1)
	jk2005	arsB	Arsenite efflux membrane protein
	jk2004	arsC	Arsenate reductase (EC 1.20.4.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD