Regulon of ArsR in Corynebacterium efficiens YS-314

Properties
Regulator type:	Transcription factor
TF locus tag:	CE0874
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:	Arsenite; Arsenate
Regulog:	ArsR - Corynebacteriaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By TF family - ArsR
By effector - Arsenite
By effector - Arsenate
By pathway - Arsenic resistance

Regulated operons
	Locus Tag	Name	Function
Position: 30 Score: 5.9 Sequence: GTATTGATTGTTATCAATAT Position: 64 Score: 6.4 Sequence: ATATTGATGACTGTCAATAT Locus tag: CE0874 Name: arsR Funciton: Arsenic resistance transcriptional regulator ArsR, ArsR family
	CE0874	arsR	Arsenic resistance transcriptional regulator ArsR, ArsR family
Position: -70 Score: 6.4 Sequence: ATATTGACAGTCATCAATAT Position: -36 Score: 5.9 Sequence: ATATTGATAACAATCAATAC Locus tag: CE0875 Name: arsB Funciton: Arsenite efflux membrane protein
	CE0875	arsB	Arsenite efflux membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD