Regulon of QacR in Corynebacterium diphtheriae NCTC 13129

Properties
Regulator type:	Transcription factor
TF locus tag:	DIP1942
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Drug resistance
Effector:
Regulog:	QacR - Corynebacteriaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By TF family - TetR
By pathway - Drug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -34 Score: 7.8 Sequence: GAAACTGTAACGAACGTTCGGTATTGTTTC Locus tag: DIP1941 Name: qacA Funciton: Antiseptic resistance protein Locus tag: DIP1942 Name: qacR Funciton: Drugs resistance transcriptional regulator protein QacR, TetR family
	DIP1941	qacA	Antiseptic resistance protein
	DIP1942	qacR	Drugs resistance transcriptional regulator protein QacR, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD