Regulog QacR - Corynebacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Drug resistance |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Corynebacteriaceae
- By TF family - TetR
- By pathway - Drug resistance
| Genome | Genes | Operons |
|---|---|---|
| Corynebacterium amycolatum SK46 | 2 | 1 |
| Corynebacterium aurimucosum ATCC 700975 | 1 | 1 |
| Corynebacterium diphtheriae NCTC 13129 | 2 | 1 |
| Corynebacterium efficiens YS-314 | ||
| Corynebacterium glutamicum ATCC 13032 | 3 | 1 |
| Corynebacterium jeikeium K411 | ||
| Corynebacterium kroppenstedtii DSM 44385 | ||
| Corynebacterium urealyticum DSM 7109 | 2 | 1 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| qacA |
*
Corynebacterium amycolatum SK46 Site: position = -34 score = 8.027 sequence = GTAACTAAACCGAACGTTCGTTACAGTTAC Gene: CORAM0001_0553: Antiseptic resistance protein |
*
Corynebacterium aurimucosum ATCC 700975 Site: position = -35 score = 7.96893 sequence = GAAACTGTAACGACCGTTCGCTATAGTTTC Gene: cauri_2196: Antiseptic resistance protein |
*
Corynebacterium diphtheriae NCTC 13129 Site: position = -34 score = 7.81005 sequence = GAAACTGTAACGAACGTTCGGTATTGTTTC Gene: DIP1941: Antiseptic resistance protein |
Gene: CE2495: Antiseptic resistance protein |
*
Corynebacterium glutamicum ATCC 13032 Site: position = -35 score = 8.23423 sequence = GTAACTGTACCGACCATTCGTTACAGTTAC Gene: cg2893: Antiseptic resistance protein |
Gene: jk0097: Antiseptic resistance protein |
|
*2
Corynebacterium urealyticum DSM 7109 Gene: cur_0110: Antiseptic resistance protein Site: position = -55 score = 7.0676 sequence = ATAACTACACCATCCATCCGGTACACTTAC Gene: cur_0020: Antiseptic resistance protein |
Antiseptic resistance protein |
| qacR |
Gene: CORAM0001_0552: Drugs resistance transcriptional regulator protein QacR, TetR family |
Gene: cauri_2199: Drugs resistance transcriptional regulator protein QacR, TetR family |
Gene: DIP1942: Drugs resistance transcriptional regulator protein QacR, TetR family |
|
Gene: cg2894: Drugs resistance transcriptional regulator protein QacR, TetR family |
|
|
Gene: cur_0019: Drugs resistance transcriptional regulator protein QacR, TetR family |
Drugs resistance transcriptional regulator protein QacR, TetR family |
| qacX |
|
|
|
Gene: CE2496: Predicted permease |
Gene: cg2895: Predicted permease |
|
|
|
Predicted permease |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |