Regulon of NrtR in Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Properties
Regulator type:	Transcription factor
TF locus tag:	LBUL_0282
Regulator family:	NrtR
Regulation mode:
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Lactobacillaceae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By trascription factor - NrtR
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 6 Sequence: TTTAGGTAAGTTATACTTTTA Locus tag: LBUL_0279 Name: pncA Funciton: Nicotinamidase (EC 3.5.1.19)
	LBUL_0279	pncA	Nicotinamidase (EC 3.5.1.19)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD