Regulon of NagR in Streptococcus suis 05ZYH33

Properties
Regulator type:	Transcription factor
TF locus tag:	SSU05_0874
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine-6-phosphate
Regulog:	NagR - Streptococcaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 66 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By trascription factor - NagR
By TF family - GntR/Others
By effector - N-acetylglucosamine-6-phosphate
By pathway - N-acetylglucosamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -60 Score: 6.5 Sequence: AAATTGGTCTATACCATATA Position: -28 Score: 5.3 Sequence: AAAATGGTATAGACCAAAGA Locus tag: SSU05_0634 Name: nagB Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
	SSU05_0634	nagB	Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Position: -135 Score: 6 Sequence: AAATTAGACTAGACCAATTA Position: -57 Score: 5.9 Sequence: AAATTAGACTAGACCAATTT Locus tag: SSU05_0549 Name: glmS Funciton: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
	SSU05_0549	glmS	Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD